Mature sequence hsa-miR-876-5p

Accession numberMIMAT0004924
IDhsa-miR-876-5p
Stem-Loop hsa-mir-876
Sequence
uggauuucuuugugaaucacca
Get sequence
Deep sequencing677 reads, 75 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).