Mature sequence hsa-miR-888-3p

Accession numberMIMAT0004917
IDhsa-miR-888-3p
Previous IDshsa-miR-888*
Stem-Loop hsa-mir-888
Sequence
gacugacaccucuuugggugaa
Get sequence
Deep sequencing2190 reads, 14 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).