Mature sequence hsa-miR-888-5p

Accession numberMIMAT0004916
IDhsa-miR-888-5p
Previous IDshsa-miR-888
Stem-Loop hsa-mir-888
Sequence
uacucaaaaagcugucaguca
Get sequence
Deep sequencing46616 reads, 56 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).