Mature sequence hsa-miR-298

Accession numberMIMAT0004901
IDhsa-miR-298
Stem-Loop hsa-mir-298
Sequence
agcagaagcagggagguucuccca
Get sequence
Deep sequencing10 reads, 10 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).