Mature sequence hsa-miR-500a-5p

Accession numberMIMAT0004773
IDhsa-miR-500a-5p
Previous IDshsa-miR-500;hsa-miR-500a
Stem-Loop hsa-mir-500a
Sequence
uaauccuugcuaccugggugaga
Get sequence
Deep sequencing14661 reads, 149 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).