Mature sequence hsa-miR-18b-3p

Accession numberMIMAT0004751
IDhsa-miR-18b-3p
Previous IDshsa-miR-18b*
Stem-Loop hsa-mir-18b
Sequence
ugcccuaaaugccccuucuggc
Get sequence
Deep sequencing381 reads, 76 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15944709 "c-Myc-regulated microRNAs modulate E2F1 expression" O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT Nature. 435:839-843(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).