Mature sequence hsa-miR-106b-3p

Accession numberMIMAT0004672
IDhsa-miR-106b-3p
Previous IDshsa-miR-106b*
Stem-Loop hsa-mir-106b
Sequence
ccgcacuguggguacuugcugc
Get sequence
Deep sequencing32925 reads, 159 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).