Mature sequence hsa-miR-155-3p

Accession numberMIMAT0004658
IDhsa-miR-155-3p
Previous IDshsa-miR-155*
Stem-Loop hsa-mir-155
Sequence
cuccuacauauuagcauuaaca
Get sequence
Deep sequencing192 reads, 28 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
4
PMID:15738415 "Accumulation of miR-155 and BIC RNA in human B cell lymphomas" Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E, Dahlberg JE Proc Natl Acad Sci U S A. 102:3627-3632(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).