Mature sequence hsa-miR-33a-3p

Accession numberMIMAT0004506
IDhsa-miR-33a-3p
Previous IDshsa-miR-33a*
Stem-Loop hsa-mir-33a
Sequence
caauguuuccacagugcaucac
Get sequence
Deep sequencing5344 reads, 138 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).