Mature sequence hsa-miR-297

Accession numberMIMAT0004450
IDhsa-miR-297
Stem-Loop hsa-mir-297
Sequence
auguaugugugcaugugcaug
Get sequence
Deep sequencing24 reads, 6 experiments
Predicted targets

References

1
PMID:17322031 "Suppression of microRNA-silencing pathway by HIV-1 during virus replication" Triboulet R, Mari B, Lin YL, Chable-Bessia C, Bennasser Y, Lebrigand K, Cardinaud B, Maurin T, Barbry P, Baillat V, Reynes J, Corbeau P, Jeang KT, Benkirane M Science. 315:1579-1582(2007).