Mature sequence ppt-miR171a

• Accession number: MIMAT0004375
• ID: ppt-miR171a
• Sequence: ugagccgcgccaauaucacau
• Stem-Loop: ppt-MIR171a

References

1. PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2. PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).