Mature sequence bta-miR-374a

Accession numberMIMAT0004342
IDbta-miR-374a
Previous IDsbta-miR-374
Stem-Loop bta-mir-374a
Sequence
uuauaauacaaccugauaagug
Get sequence
Deep sequencing5355 reads, 73 experiments
Predicted targets

References

1