Mature sequence ppt-miR319d-5p.1

Accession numberMIMAT0004325
IDppt-miR319d-5p.1
Previous IDsppt-miR319d.1*
Stem-Loop ppt-MIR319d
Sequence
gagcuuucuucgguccaaua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).