Mature sequence cbr-miR-392

Accession numberMIMAT0004299
IDcbr-miR-392
Stem-Loop cbr-mir-392
Sequence
uaucaucgaucaugugagcugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).