Mature sequence hsa-miR-675-5p

Accession numberMIMAT0004284
IDhsa-miR-675-5p
Previous IDshsa-miR-675
Stem-Loop hsa-mir-675
Sequence
uggugcggagagggcccacagug
Get sequence
Deep sequencing1092 reads, 84 experiments
Database links
Predicted targets
QuickGO function

References

1
2
PMID:18402656 "Hidden layers of human small RNAs" Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y BMC Genomics. 9:157(2008).