Mature sequence ath-miR854c

Accession numberMIMAT0004282
IDath-miR854c
Stem-Loop ath-MIR854c
Sequence
gaugaggauagggaggaggag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17189346 "A family of microRNAs present in plants and animals" Arteaga-Vazquez M, Caballero-Perez J, Vielle-Calzada JP Plant Cell. 18:3355-3369(2006).