Mature sequence ath-miR833a-5p

Accession numberMIMAT0004252
IDath-miR833a-5p
Previous IDsath-miR833-5p
Stem-Loop ath-MIR833a
Sequence
uguuuguuguacucggucuagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).