Mature sequence mmu-miR-804

Accession numberMIMAT0004210
IDmmu-miR-804
Stem-Loop mmu-mir-804
Sequence
ugugaguuguuccucaccugga
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).