Mature sequence mdo-miR-367

Accession numberMIMAT0004184
IDmdo-miR-367
Stem-Loop mdo-mir-367
Sequence
gaauugcacuuuagcaaugguga
Get sequence
Deep sequencing3 reads, 2 experiments
Predicted targets

References

1