Mature sequence osa-miR821c

Accession numberMIMAT0004084
IDosa-miR821c
Stem-Loop osa-MIR821c
Sequence
aagucaucaacaaaaaaguugaau
Get sequence
Deep sequencing5 reads, 2 experiments

References

1