Mature sequence osa-miR821b

Accession numberMIMAT0004083
IDosa-miR821b
Stem-Loop osa-MIR821b
Sequence
aagucaucaacaaaaaaguugaau
Get sequence
Deep sequencing3 reads, 1 experiments

References

1