Mature sequence osa-miR821a

Accession numberMIMAT0004082
IDosa-miR821a
Stem-Loop osa-MIR821a
Sequence
aagucaucaacaaaaaaguugaau
Get sequence
Deep sequencing3 reads, 1 experiments

References

1