Mature sequence osa-miR820c

Accession numberMIMAT0004081
IDosa-miR820c
Stem-Loop osa-MIR820c
Sequence
ucggccucguggauggaccag
Get sequence
Deep sequencing2373 reads, 2 experiments
Database links
QuickGO function

References

1
2
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
3
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).