Mature sequence osa-miR812a

Accession numberMIMAT0004049
IDosa-miR812a
Stem-Loop osa-MIR812a
Sequence
gacggacgguuaaacguuggac
Get sequence
Deep sequencing5160 reads, 2 experiments
Database links
QuickGO function

References

1