Mature sequence hsa-miR-765

Accession numberMIMAT0003945
IDhsa-miR-765
Stem-Loop hsa-mir-765
Sequence
uggaggagaaggaaggugaug
Get sequence
Deep sequencing399 reads, 76 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).