Mature sequence mmu-miR-763

Accession numberMIMAT0003896
IDmmu-miR-763
Stem-Loop mmu-mir-763
Sequence
ccagcugggaagaaccaguggc
Get sequence
Deep sequencing3 reads, 3 experiments
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).