Mature sequence mtr-miR395n

Accession numberMIMAT0003867
IDmtr-miR395n
Stem-Loop mtr-MIR395n
Sequence
augaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).