Mature sequence bta-miR-214

Accession numberMIMAT0003825
IDbta-miR-214
Stem-Loop bta-mir-214
Sequence
acagcaggcacagacaggcagu
Get sequence
Deep sequencing7786 reads, 64 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).