Mature sequence bta-miR-186

Accession numberMIMAT0003818
IDbta-miR-186
Stem-Loop bta-mir-186
Sequence
caaagaauucuccuuuugggcu
Get sequence
Deep sequencing476896 reads, 78 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2