Mature sequence bta-miR-142-3p

• Accession number: MIMAT0003791
• ID: bta-miR-142-3p
• Previous IDs: bta-miR-142*
• Stem-Loop: bta-mir-142
• Sequence: aguguuuccuacuuuauggaug
• Deep sequencing: 33373 reads, 70 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-142-3p

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).