Mature sequence dre-miR-723-3p

Accession numberMIMAT0003751
IDdre-miR-723-3p
Previous IDsdre-miR-723
Stem-Loop dre-mir-723
Sequence
aagacaucaauuaaaucugugcu
Get sequence
Deep sequencing11 reads, 3 experiments
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).