Mature sequence xtr-miR-18b

Accession numberMIMAT0003706
IDxtr-miR-18b
Stem-Loop xtr-mir-18b
Sequence
uaaggugcaucuagugcaguuag
Get sequence
Deep sequencing reads, experiments
Predicted targets

References