Mature sequence xtr-miR-451

Accession numberMIMAT0003705
IDxtr-miR-451
Stem-Loop xtr-mir-451
Sequence
aaaccguuaccauuacugaguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References