Mature sequence xtr-miR-208

Accession numberMIMAT0003698
IDxtr-miR-208
Stem-Loop xtr-mir-208
Sequence
auaagacgagcauaaagcuugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References