Mature sequence xtr-miR-191

Accession numberMIMAT0003689
IDxtr-miR-191
Stem-Loop xtr-mir-191
Sequence
caacggaaucccaaaagcagcu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References