Mature sequence xtr-miR-29c-5p

Accession numberMIMAT0003676
IDxtr-miR-29c-5p
Previous IDsxtr-miR-29c*
Stem-Loop xtr-mir-29c
Sequence
ugaccgaucucucuugguguuc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References