Mature sequence xtr-miR-20a-3p

Accession numberMIMAT0003670
IDxtr-miR-20a-3p
Previous IDsxtr-miR-20a*
Stem-Loop xtr-mir-20a
Sequence
acugcauaaugagcacuuaaa
Get sequence
Deep sequencing reads, experiments
Predicted targets

References