Mature sequence xtr-miR-30d

Accession numberMIMAT0003657
IDxtr-miR-30d
Stem-Loop xtr-mir-30d
Sequence
uguaaacauccccgacuggaag
Get sequence
Deep sequencing reads, experiments
Predicted targets

References