Mature sequence xtr-miR-455

Accession numberMIMAT0003641
IDxtr-miR-455
Stem-Loop xtr-mir-455
Sequence
uaugugcccuuggacuacaucg
Get sequence
Deep sequencing reads, experiments
Predicted targets

References