Mature sequence xtr-miR-216

Accession numberMIMAT0003629
IDxtr-miR-216
Stem-Loop xtr-mir-216
Sequence
uaaucucagcuggcaacugug
Get sequence
Deep sequencing reads, experiments
Predicted targets

References