Mature sequence xtr-miR-215

Accession numberMIMAT0003628
IDxtr-miR-215
Stem-Loop xtr-mir-215
Sequence
augaccuaugaaaugacagcc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References