Mature sequence xtr-miR-205b

Accession numberMIMAT0003622
IDxtr-miR-205b
Stem-Loop xtr-mir-205b
Sequence
uccuucauuccaccggauccug
Get sequence
Deep sequencing reads, experiments
Predicted targets

References