Mature sequence xtr-miR-181b

Accession numberMIMAT0003609
IDxtr-miR-181b
Stem-Loop xtr-mir-181b-1 xtr-mir-181b-2
Sequence
aacauucauugcugucgguggg
Get sequence
Deep sequencing reads, experiments
Predicted targets

References