Mature sequence xtr-miR-148b

Accession numberMIMAT0003605
IDxtr-miR-148b
Stem-Loop xtr-mir-148b
Sequence
ucagugcaucacagaacuuugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References