Mature sequence xtr-miR-130c

Accession numberMIMAT0003592
IDxtr-miR-130c
Stem-Loop xtr-mir-130c
Sequence
cagugcaauauuaaaagggcau
Get sequence
Deep sequencing reads, experiments
Predicted targets

References