Mature sequence mmu-miR-717

Accession numberMIMAT0003510
IDmmu-miR-717
Stem-Loop mmu-mir-717
Sequence
cucagacagagauaccuucucu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).