Mature sequence mmu-miR-669a-5p

Accession numberMIMAT0003477
IDmmu-miR-669a-5p
Previous IDsmmu-miR-669a
Stem-Loop mmu-mir-669a-1 mmu-mir-669a-2 mmu-mir-669a-3 mmu-mir-669a-4 mmu-mir-669a-5 mmu-mir-669a-6 mmu-mir-669a-7 mmu-mir-669a-8 mmu-mir-669a-9 mmu-mir-669a-10 mmu-mir-669a-11 mmu-mir-669a-12
Sequence
aguugugugugcauguucaugucu
Get sequence
Deep sequencing946140 reads, 103 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).