Mature sequence dre-miR-27c-5p

Accession numberMIMAT0003401
IDdre-miR-27c-5p
Previous IDsdre-miR-27c*
Stem-Loop dre-mir-27c dre-mir-27c-2
Sequence
cuuaacccacuugugaacaaug
Get sequence
Deep sequencing7184 reads, 9 experiments
Database links
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).