Mature sequence rno-miR-505-3p

Accession numberMIMAT0003380
IDrno-miR-505-3p
Previous IDsrno-miR-505
Stem-Loop rno-mir-505
Sequence
gucaacacuugcugguuucc
Get sequence
Deep sequencing30736 reads, 490 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).