Mature sequence gga-miR-466

Accession numberMIMAT0003370
IDgga-miR-466
Stem-Loop gga-mir-466
Sequence
auauauacacacacacauaagac
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References